View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_68 (Length: 306)
Name: NF1243_low_68
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 71 - 228
Target Start/End: Complemental strand, 53566541 - 53566384
Alignment:
| Q |
71 |
agacctttcaacattgaggtgacaaatccggggaaaaattacaacactgaatatgattacttaccaacttagtaaatttgaacctactaacttaatatta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53566541 |
agacctttcaacattgaggtgacaaatccgggaaaaaattacaacactaaacatgattacttaccaacttagtaaatttgaacctactaacttaatatta |
53566442 |
T |
|
| Q |
171 |
aacaaacatataatcactttttaattgagtttcatgaaaagtgggtaatggtgcacac |
228 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53566441 |
aacaaacatataatccctttttaattgagtttcatgaaaagcgggtaatggtgcacac |
53566384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University