View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_low_70 (Length: 304)

Name: NF1243_low_70
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_low_70
NF1243_low_70
[»] chr5 (1 HSPs)
chr5 (97-218)||(34590804-34590925)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 218
Target Start/End: Original strand, 34590804 - 34590925
Alignment:
97 ctctgaactcccaagaggcgaggttaccttttcagcaatcaactgaatttccttcaccctatcctgaactaactttcggagttgctcttcttggcttgtc 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34590804 ctctgaactcccaagaggcgaggttaccttttcagcaatcaactgaatttccttcaccctatcctgaactaactttcggagttgctcttcttggcttgtc 34590903  T
197 tgattgtcatccatctgtacag 218  Q
    ||||||||||||||||||||||    
34590904 tgattgtcatccatctgtacag 34590925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University