View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_70 (Length: 304)
Name: NF1243_low_70
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 218
Target Start/End: Original strand, 34590804 - 34590925
Alignment:
| Q |
97 |
ctctgaactcccaagaggcgaggttaccttttcagcaatcaactgaatttccttcaccctatcctgaactaactttcggagttgctcttcttggcttgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590804 |
ctctgaactcccaagaggcgaggttaccttttcagcaatcaactgaatttccttcaccctatcctgaactaactttcggagttgctcttcttggcttgtc |
34590903 |
T |
 |
| Q |
197 |
tgattgtcatccatctgtacag |
218 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34590904 |
tgattgtcatccatctgtacag |
34590925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University