View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_72 (Length: 299)
Name: NF1243_low_72
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_72 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 196 - 299
Target Start/End: Complemental strand, 6069773 - 6069666
Alignment:
| Q |
196 |
gacaaaaaataaatattattcatatttatttagttcttaa----caaatattattctttcttgtagataactcaattgaaaaattgatgaataaatgaat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
6069773 |
gacaaaaaataaatattattcatatttatttagttattaattaacaaatattattctttcttgtagataactcaattgaaaaactgatgaataactgaat |
6069674 |
T |
 |
| Q |
292 |
gacagctt |
299 |
Q |
| |
|
|||||||| |
|
|
| T |
6069673 |
gacagctt |
6069666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University