View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_79 (Length: 293)
Name: NF1243_low_79
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 43673941 - 43674198
Alignment:
| Q |
7 |
gaagcaaaggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggtaggcagtatttcctttttaacaacatttttcattaatttgtct |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43673941 |
gaagccaaggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggtaggcagtatttcctttttaacaacatttttcattaatttgtct |
43674040 |
T |
|
| Q |
107 |
tctccaataaggtggttttaagtgtaacccacattttctttgaaaatccaatcactgggtttgnnnnnnnccacatgggtccatcatcatatctaacgcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43674041 |
tctccaataaggtggttttaagtgtaacccacattttctttgaaaatccaatcactgggtttgtttttttccacatgggtccatcatcatatctaacgcc |
43674140 |
T |
|
| Q |
207 |
aaatttgagcttcagttgcctagaatcacctaggtttgatgcgagtggtggagagtaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43674141 |
aaatttgagcttcagttgcctagaatcacctaggtttgatgcgagtggtggagagtaa |
43674198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 43400628 - 43400572
Alignment:
| Q |
7 |
gaagcaaaggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggt |
63 |
Q |
| |
|
|||||| ||||||||||| |||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
43400628 |
gaagcagaggaggacaattgttctccgcagttgggatgtagagaaatttggcatggt |
43400572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University