View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_90 (Length: 273)
Name: NF1243_low_90
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_90 |
 |  |
|
| [»] scaffold0658 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 46445892 - 46446124
Alignment:
| Q |
13 |
aatatccacttcccaatgtgccaatgcccggtgatcgagttccaatatttttatcgatgggagatcatctttcttgcattgcatacaaagatgaaattta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46445892 |
aatatccacttcccaatgtgccaatgcccggtgatcgagttccaatatttttatcgatgggagatcatctttcttgcattgcatataaagatgaaattta |
46445991 |
T |
 |
| Q |
113 |
tgaagcatatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445992 |
tgaagcatatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgag |
46446091 |
T |
 |
| Q |
213 |
cttaataatttgtcttcagtggtatttcgtttt |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
46446092 |
cttaataatttgtcttcggtggtatttcgtttt |
46446124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 60 - 199
Target Start/End: Complemental strand, 46672228 - 46672089
Alignment:
| Q |
60 |
tttttatcgatgggagatcatctttcttgcattgcatacaaagatgaaatttatgaagcatatcaaatctacattttggattttgattcgggggaatggt |
159 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
46672228 |
tttttattgatgggaaatcacctttcttgcattgtgtacaaagataaaattaatgaagcatatcaaatctacattttggattttgattcaggaaaatggt |
46672129 |
T |
 |
| Q |
160 |
ctctttatcatgagatgggacattttgattatgtggctgc |
199 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46672128 |
ctctctatcatgcgatgggacattttgattatgtggctgc |
46672089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 126 - 244
Target Start/End: Complemental strand, 5054277 - 5054162
Alignment:
| Q |
126 |
atctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgagcttaataatttgt |
225 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||||||||| ||||| || |||||||||||| ||| ||||| |
|
|
| T |
5054277 |
atctatattttggattttgatacgggaaaatggtctcattatcatgagatgggaccttttgattatgttgctgcttgcggtcatgagcttgatactttgt |
5054178 |
T |
 |
| Q |
226 |
cttcagtggtatttcgttt |
244 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
5054177 |
at---gtggtatttcgttt |
5054162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 118 - 219
Target Start/End: Original strand, 9841987 - 9842088
Alignment:
| Q |
118 |
catatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgagcttaa |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||||||||| ||||||||||||||| ||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
9841987 |
catatcaaatctacattctggattttgattcaggaaaatggtctcttcatcatgagatgggaccttttgattatgtgtctgcttgtggtcataggcttaa |
9842086 |
T |
 |
| Q |
218 |
ta |
219 |
Q |
| |
|
|| |
|
|
| T |
9842087 |
ta |
9842088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 131 - 215
Target Start/End: Original strand, 9860641 - 9860725
Alignment:
| Q |
131 |
cattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgagctt |
215 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||||||||||| ||||||||||||| |||| |||||||| |||||| |
|
|
| T |
9860641 |
cattttggatcatgattcaggaaaatggtctctttatcatgagatgggaccttttgattatgtgtctgcttgtggtcaagagctt |
9860725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 118 - 199
Target Start/End: Original strand, 27360975 - 27361056
Alignment:
| Q |
118 |
catatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgc |
199 |
Q |
| |
|
||||||||||||| | |||||||||||||| || ||||| |||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
27360975 |
catatcaaatctatactttggattttgatttaggaaaatggaatctttatcatgagatgggaccttttgattacgaggctgc |
27361056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 2326427 - 2326337
Alignment:
| Q |
122 |
tcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggtcatgag |
212 |
Q |
| |
|
|||||||||||||||| |||||||||| || ||| ||||||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
2326427 |
tcaaatctacattttgaattttgattcaggaaaattgtctctttatcatgagatgggaccatttgattatgtggctacttgtggtcatgag |
2326337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 199
Target Start/End: Original strand, 39576365 - 39576445
Alignment:
| Q |
119 |
atatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgc |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
39576365 |
atatcaaatctacactttggattttgattcaggagaatggtctctttatcatgagatgggacctttcaattatgttgctgc |
39576445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 119 - 206
Target Start/End: Original strand, 39572359 - 39572446
Alignment:
| Q |
119 |
atatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgcctgtggt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||||||| ||||||||||||||||| |||||||||||| ||||| |||||| |
|
|
| T |
39572359 |
atatccaatctacattttggattttgattcaagaaaatggtctccttatcatgagatgggaccttttgattatgttgctgcttgtggt |
39572446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 4100584 - 4100463
Alignment:
| Q |
68 |
gatgggagatcatctttcttgcattgcatacaaagatgaaatttatgaagcatatcaaatctacattttggattttgattcgggggaatggtctctttat |
167 |
Q |
| |
|
||||||| |||||||||||||||| | | || |||| | ||||| | ||| |||||||||||||||||||||||| | || |||||||||||||| |
|
|
| T |
4100584 |
gatgggaaatcatctttcttgcatagtgaataatgatgcattttatagaacatttcaaatctacattttggattttgagttaggaaaatggtctctttat |
4100485 |
T |
 |
| Q |
168 |
catgagatgggacattttgatt |
189 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
4100484 |
catgagatgggaccttttgatt |
4100463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 57 - 189
Target Start/End: Original strand, 4146452 - 4146584
Alignment:
| Q |
57 |
atatttttatcgatgggagatcatctttcttgcattgcatacaaagatgaaatttatgaagcatatcaaatctacattttggattttgattcgggggaat |
156 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||| | || |||| | ||| | | ||| ||||||||| ||||||||||||| | || ||| |
|
|
| T |
4146452 |
atatttttagggatgggaaatcacctttcttgcattgtgaataatgatgcattttgtagaacatttcaaatctatgttttggattttgagttaggaaaat |
4146551 |
T |
 |
| Q |
157 |
ggtctctttatcatgagatgggacattttgatt |
189 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
4146552 |
ggtctctttatcatgagatgggaccttttgatt |
4146584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 198
Target Start/End: Original strand, 225390 - 225434
Alignment:
| Q |
154 |
aatggtctctttatcatgagatgggacattttgattatgtggctg |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
225390 |
aatggtctctttatcatgagatctgaccttttggttatgtggctg |
225434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 189
Target Start/End: Original strand, 7256838 - 7256908
Alignment:
| Q |
119 |
atatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgatt |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||||||||||||| |||||||| |||||||| |
|
|
| T |
7256838 |
atatcaaatctacattttagattttgattcaagaaaatggtctctttatcatatgatgggaccttttgatt |
7256908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0658 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0658
Description:
Target: scaffold0658; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 118 - 199
Target Start/End: Complemental strand, 2922 - 2841
Alignment:
| Q |
118 |
catatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggctgc |
199 |
Q |
| |
|
||||||||||||| | |||||||||||||| || ||||| |||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
2922 |
catatcaaatctatactttggattttgatttaggaaaatggaatctttatcatgagatgggaccttttgattacgaggctgc |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 197
Target Start/End: Complemental strand, 112711 - 112631
Alignment:
| Q |
117 |
gcatatcaaatctacattttggattttgattcgggggaatggtctctttatcatgagatgggacattttgattatgtggct |
197 |
Q |
| |
|
|||||||||||||| ||||||||| |||| || ||||| ||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
112711 |
gcatatcaaatctatgctttggatttggatttaggaaaatggactctttatcatgagatggggccttttgattatggggct |
112631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University