View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_91 (Length: 271)
Name: NF1243_low_91
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 32 - 183
Target Start/End: Original strand, 6675663 - 6675814
Alignment:
| Q |
32 |
aaaggcaccaatggctatgatgcactatgtacaagagacaaagatgcaagagaacaaaagaaaggtcgtgaccaacaaagtttggaagtatcagaatatg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6675663 |
aaaggcaccaatggctatgatgcactatgtacaagagacaaagatgcaagagaacaaaagaaaggtcgtgaccaacaaagtttggaagtatcagaatatg |
6675762 |
T |
|
| Q |
132 |
cagtgcagttagtcccacatcgacaaagaaaagtagtatgatagtgtttata |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6675763 |
cagtgcagttagtcccacatcgacaaagaaaagtagtatgatagtgtttata |
6675814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University