View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_92 (Length: 270)
Name: NF1243_low_92
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 48 - 236
Target Start/End: Original strand, 40970196 - 40970384
Alignment:
| Q |
48 |
agttcaaatatttgttgaggtgttatatatgcatggagactgagaactcccctgagacttcaaatgggaaaagattatatattgaattaccttcattcat |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970196 |
agttcaaatatttgttgaggtgttatacatgcatggagactgagaactcccctgagacttcaaatgggaaaagattatatattgaattaccttcattcat |
40970295 |
T |
|
| Q |
148 |
gtgaacttagtactcctaatgaatatttcaatcactttggtaaattaaattgatatccaaaataaacttttgaacatatctactcaaag |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970296 |
gtgaacttagtactcctaatgaatatttcaatcactttggtaaattaaattgatatccaaaataaacttttgaacatatctactcaaag |
40970384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University