View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12440_high_4 (Length: 335)
Name: NF12440_high_4
Description: NF12440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12440_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 2910676 - 2910371
Alignment:
| Q |
19 |
catcaacggtttcaacaacaacgttaacttcctcggaaatctcgtcttaacaatctcaacctcacttgtgggtcccactgcaactccaaccgtcacaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2910676 |
catcaacggtttcaacaacaacgttaacttcctcggagatctcgtcttaacaatctcaacctcacttgtgggtcccactgcaactccaaccgtcacaaac |
2910577 |
T |
 |
| Q |
119 |
tatgcacaccaactgtttgctcaaattccccaaccagacacatttatgtataatgtcatgattcgaggttcatctcagagccctaatcctttacgagcta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2910576 |
tatgcacaccaactgtttgctcaaattccccaaccagacacatttatgtataatgtcatgattcgaggttcatctcagagccctaatcctttacgagcta |
2910477 |
T |
 |
| Q |
219 |
tttcgttgtatacggaaatgcatcgacattttgttaagggtgatagctacacttttccgtttgttcttaaggcgtgtactaggcttttttgggttaacac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2910476 |
tttcgttgtatacggaaatgcatcgacattttgttaagggtgatagctacacttttccgtttgttcttaaggcgtgtactaggcttttttgggttaacac |
2910377 |
T |
 |
| Q |
319 |
aggttc |
324 |
Q |
| |
|
||||| |
|
|
| T |
2910376 |
tggttc |
2910371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University