View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12440_low_16 (Length: 236)
Name: NF12440_low_16
Description: NF12440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12440_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 34079217 - 34078992
Alignment:
| Q |
1 |
acagactaccatgtctcaaaatgctattaccttgccaccatttcctggtagggagtgtgctatagaagggaacaccgatccacaaaaccatcttttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079217 |
acagactaccatgtctcaaaatgctattaccttgccaccatttcctggtagggagtgtgctatagaagggaacaccgatccacaaaaccatcttttgttt |
34079118 |
T |
|
| Q |
101 |
ggttttaacatagagccctcatcacatctagtttacaatgagatgtctaaccttaagagggtcaatagcaactgtgactcatcaactgcaccttttcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079117 |
ggttttaacatagagccctcatcacatctagtttacaatgagatgtctaaccttaagagggtcaatagcaactgtgactcatcaactgcaccttttcaat |
34079018 |
T |
|
| Q |
201 |
cttccacctacttgaataccacaggt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34079017 |
cttccacctacttgaataccacaggt |
34078992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 5907633 - 5907587
Alignment:
| Q |
11 |
atgtctcaaaatgctattaccttgccaccatttcctggtagggagtg |
57 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5907633 |
atgtctcaaaatgctattacattgccaccatttcctggtagggagtg |
5907587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University