View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12440_low_18 (Length: 211)
Name: NF12440_low_18
Description: NF12440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12440_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 11833766 - 11833583
Alignment:
| Q |
16 |
caaagagatctagaaagcactaggaagaaatctttctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcaatgacatggatttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11833766 |
caaagagatctagaaagcactaggaagaaatctctctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcgatgacatggatttt |
11833667 |
T |
 |
| Q |
116 |
gaatgtggggcattatcgtgtgaacggtggctttgccactatgcatagttttccatactttcggatctgcaacgttgatgtcca |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833666 |
gaatgtggggcattatcgtgtcaacggtggcttcgccactatgcatagctttccatactttcggatctgcaacgttgatgtcca |
11833583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 7677836 - 7677877
Alignment:
| Q |
168 |
ccatactttcggatctgcaacgttgatgtccatctcattgct |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7677836 |
ccatgctttcggatctgcaacgttgatgtccaaatcattgct |
7677877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University