View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12441_low_18 (Length: 255)
Name: NF12441_low_18
Description: NF12441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12441_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 17067986 - 17068222
Alignment:
| Q |
17 |
acatcaagtatatttcaagtagacggttggaagtgcctatcccccaccctcctaaactaccccttgtctaaaattagctattacagtattagagattttt |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17067986 |
acatcaagtatatttcaagtagacagttggaagtgcctatcccccacactcctaaactaccccttgtctaaaattagctattacagtattagagattttt |
17068085 |
T |
 |
| Q |
117 |
gccaagcctactgggcagatactaacctttgttttgtaggtttgtagatatcgtccaattgaagacgagtttaactctccaaacccagctgagttacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
17068086 |
gccaagcctactgggcagatactaacctttgttttgtaggtttgtagatatcgtccgattgaagacgagtttaactctccaaacctatctgagttacaaa |
17068185 |
T |
 |
| Q |
217 |
agtacctaactgatgaggatcacaggttctgctcgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
17068186 |
agtacctaactgatgaggatcacaggttatgcccgtt |
17068222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 17068228 - 17068264
Alignment:
| Q |
187 |
ttaactctccaaacccagctgagttacaaaagtacct |
223 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
17068228 |
ttaactctccaaacctacctgagttacaaaagtacct |
17068264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University