View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12445_high_10 (Length: 245)

Name: NF12445_high_10
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12445_high_10
NF12445_high_10
[»] chr5 (1 HSPs)
chr5 (20-230)||(32049304-32049515)


Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 20 - 230
Target Start/End: Original strand, 32049304 - 32049515
Alignment:
20 tctagagtagggcatgaggcgtctggagcatggcgtgaggcgcctggttggaaggagcgcaagtcattgttctgcacaatgttgaaggggaaatgtgaga 119  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |  |||||||||    
32049304 tctagagtagggcatgaggcgtctggagcatagcgtgaggcgcctggttggaaggagcgcgagtcattgttctgcacaatgttgaagagagaatgtgaga 32049403  T
120 ggattgtgtgagatttagagaatcttgagatagcaaacatgataacttttaggaaatttaaa-ggccaggggttaagggtccttgaatgagatttttgga 218  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||| | |||||||||||||||||||||||||||||||    
32049404 ggattgtgtgagatttagagaatcttaagatagcaaacatgataacttttaggaaacttaaagggcaaagggttaagggtccttgaatgagatttttgga 32049503  T
219 tagagaagcaca 230  Q
    ||||||| ||||    
32049504 tagagaaacaca 32049515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University