View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12445_high_11 (Length: 231)

Name: NF12445_high_11
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12445_high_11
NF12445_high_11
[»] chr4 (1 HSPs)
chr4 (65-146)||(48954472-48954553)
[»] chr7 (1 HSPs)
chr7 (27-112)||(1116678-1116764)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 65 - 146
Target Start/End: Complemental strand, 48954553 - 48954472
Alignment:
65 atatatagaggaccgagctatgtaaaggaaggttttttcccttcaaaacgatactgacgtacgtggctttgtaataaaccag 146  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
48954553 atatatagaggacggagctatgtaaaggaaggttttttcccttcaaaacgatactgacgtacgtggctttgtaacaaaccag 48954472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 112
Target Start/End: Original strand, 1116678 - 1116764
Alignment:
27 tgtatgatttatacttttattttcaggtagggggaataatata--tagaggaccgagctatgtaaaggaaggttttttcccttcaaaa 112  Q
    ||||||||| ||||||||||||||||||| | | |||||||||  |||||||  || ||||||||||||  | |||||||||||||||    
1116678 tgtatgattaatacttttattttcaggta-gagtaataatatatgtagaggattgatctatgtaaaggatagctttttcccttcaaaa 1116764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University