View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12445_high_5 (Length: 404)
Name: NF12445_high_5
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12445_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 27 - 156
Target Start/End: Original strand, 6175274 - 6175403
Alignment:
| Q |
27 |
tatgtatgtatgtatgtgctcattaacttggatttttgtactgattttatcactttctccacttcttcgtaactaattttcgaaattgagtttgaccttt |
126 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6175274 |
tatgcatgtatttatgtgctcattaacttggatttttgtactgattttatcactttctccacttcttcataactaattttcgaaattgagtttgaccttt |
6175373 |
T |
|
| Q |
127 |
ttatgaagcagaacttaagcgtagagtata |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6175374 |
ttatgaagcagaacttaagcgtagagtata |
6175403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 389
Target Start/End: Original strand, 6175405 - 6175461
Alignment:
| Q |
334 |
ctaacttccatcaattgaaggtgctaacttt-gtttgatatctcagtttcggtctct |
389 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6175405 |
ctaacttccatcaattgaaagtgctaacttttgtttgatatctcagtttcggtctct |
6175461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University