View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12445_high_9 (Length: 278)
Name: NF12445_high_9
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12445_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 6685899 - 6685635
Alignment:
| Q |
11 |
cacagacggcgatattttttattttattgcattttcattattttcgtttnnnnnnnttatcgtaatttcagactaagaag---gtatatatactttttgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6685899 |
cacagacggcgatattttttattttattacattttcattattttcgtttaaaaaaattatcgtaatttcagactaagaagaaggtatatatactttttgc |
6685800 |
T |
 |
| Q |
108 |
taaa--------gaatatgagatgaacttttt-attgcatttctttaatatcagtttgcaggtcgttactttagttattaaatgtaatgttgaaaggtgt |
198 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6685799 |
taaattttacaagaatatgagataaacttttttattgcatttctttaatatcagtttgcaggtcgttactttagttattaaatgtaatgttgaaaggtgt |
6685700 |
T |
 |
| Q |
199 |
tgcattgagtgggaggacattcacattgttatcacattagtcaaattggcatggaaccaaagaac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6685699 |
tgcattgagtgggaggacattcacattgttatgacattagtcaaattggcatggaaccaaagaac |
6685635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University