View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12445_low_11 (Length: 245)
Name: NF12445_low_11
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12445_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 20 - 230
Target Start/End: Original strand, 32049304 - 32049515
Alignment:
| Q |
20 |
tctagagtagggcatgaggcgtctggagcatggcgtgaggcgcctggttggaaggagcgcaagtcattgttctgcacaatgttgaaggggaaatgtgaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
32049304 |
tctagagtagggcatgaggcgtctggagcatagcgtgaggcgcctggttggaaggagcgcgagtcattgttctgcacaatgttgaagagagaatgtgaga |
32049403 |
T |
 |
| Q |
120 |
ggattgtgtgagatttagagaatcttgagatagcaaacatgataacttttaggaaatttaaa-ggccaggggttaagggtccttgaatgagatttttgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32049404 |
ggattgtgtgagatttagagaatcttaagatagcaaacatgataacttttaggaaacttaaagggcaaagggttaagggtccttgaatgagatttttgga |
32049503 |
T |
 |
| Q |
219 |
tagagaagcaca |
230 |
Q |
| |
|
||||||| |||| |
|
|
| T |
32049504 |
tagagaaacaca |
32049515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University