View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12445_low_4 (Length: 467)
Name: NF12445_low_4
Description: NF12445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12445_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 62 - 272
Target Start/End: Complemental strand, 938597 - 938385
Alignment:
| Q |
62 |
cataacttaaatcatgaacaagaatactttactttcaccaaagaaacagatatactcacttcctaggtccacattttttcttataatatata--cacaaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
938597 |
cataacttaaatcatgaacaagaatactttactttcaccaaagaaacagatatactcacttcctaggtccacattttttcttaaaatatatatacacaaa |
938498 |
T |
 |
| Q |
160 |
aatatataattggctttgtgatagttggtttcttttgtggtcaatcattcacaaaatacaaaaacatcatggggatgatcatgagttacatgggaggatc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938497 |
tatatataattggctttgtgatagttggtttcttttgtggtcaatcattcacaaaatacaaaaacatcatggggatgatcatgagttacatgggaggatc |
938398 |
T |
 |
| Q |
260 |
aggtctcatgttc |
272 |
Q |
| |
|
||||||||||||| |
|
|
| T |
938397 |
aggtctcatgttc |
938385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 396 - 453
Target Start/End: Complemental strand, 938311 - 938254
Alignment:
| Q |
396 |
catatctcattaggtgagggaatagcatcccagacattagatcttgtgtcaggagcac |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938311 |
catatctcattaggtgagggaatagcatcccagacattagatcttgtgtcaggagcac |
938254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University