View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12446_high_2 (Length: 339)
Name: NF12446_high_2
Description: NF12446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12446_high_2 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 10 - 339
Target Start/End: Complemental strand, 26570777 - 26570448
Alignment:
| Q |
10 |
attattcttttggttatgcaccagcaatcataagttcaaggaaagtggttcaagcttataaatatcatttttatgtttgctacaagcttataaaagtcat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26570777 |
attattcttttggttatgcaccagcaatcataagttcaaggaaagtggttcaagcttataaatatcatttttatgtttgctacaagcttataaaagtcat |
26570678 |
T |
|
| Q |
110 |
tctcatatgttatttatctgtcacacaaattggtagcattacttttatagaagaagatattagaagtagcatatgacaatgacatatgatatgatgggtc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26570677 |
tctcatatgttatttatctgtcacacaaattggtagcattacttttatagaagaagatattagaagttacatatgacaatgacatatgatatgatgggtc |
26570578 |
T |
|
| Q |
210 |
acttttgttaacatgatctttgttccctgatattaatgactggcagtaatggaacatggacacaaggtagttctggagatcattttgaggagcttagcac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26570577 |
acttttgttaacatgatctttgttccctgatattaatgactggcagtaatggaacatggacacaaggtagttctggagatcattttgaggagcttagcac |
26570478 |
T |
|
| Q |
310 |
acaagaaatcctatcaactcaccacattgg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26570477 |
acaagaaatcctatcaactcaccacattgg |
26570448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University