View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12446_low_3 (Length: 315)
Name: NF12446_low_3
Description: NF12446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12446_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 21 - 314
Target Start/End: Original strand, 38533176 - 38533469
Alignment:
| Q |
21 |
ttgagaatttacccgatgaggtttacgatacggagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533176 |
ttgagaatttacccgatgaggtttacgatacggagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggc |
38533275 |
T |
 |
| Q |
121 |
ggtgttttcagctgctgttatggcgaggaataggaagggatctggtgtgacgcatgtgtttttgcatgatgtggatcgtagggttgagaaactttatgct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533276 |
ggtgttttcagctgctgttatggcgaggaataggaagggatctggtgtgacgcatgtgtttttgcatgatgtggatcgtagggttgagaaactttatgct |
38533375 |
T |
 |
| Q |
221 |
gatgagtttctttgtaagaagaatttggttaaaggtgttggaaggctttggcattttcagatagcaccgtttaatggcacaggttctgctcgtt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||| |
|
|
| T |
38533376 |
gatgagtttctttgtaagaagaatttggttaaaggtgttggaaggctttggcattttcagatagcaccgtttaatggcactgattctcctcgtt |
38533469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 35 - 273
Target Start/End: Complemental strand, 34715272 - 34715034
Alignment:
| Q |
35 |
gatgaggtttacgatacggagtgggatcttattatgatcgatgcgccgaaagggtatttcgcggaggcgccggggagaatggcggcggtgttttcagctg |
134 |
Q |
| |
|
|||||| ||||||| |||||||||||| | || |||||||||||||||| ||| ||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
34715272 |
gatgagatttacgaaacggagtgggatttgataatgatcgatgcgccgagaggttatttcgcggaggcgccggggagaatggcggcgatattttcaatga |
34715173 |
T |
 |
| Q |
135 |
ctgttatggcgaggaataggaagggatctggtgtgacgcatgtgtttttgcatgatgtggatcgtagggttgagaaactttatgctgatgagtttctttg |
234 |
Q |
| |
|
| || |||||||| ||||| || || || ||||||||||| ||||||||||||||||||||||| | |||||||||| ||||||| || || |||||||| |
|
|
| T |
34715172 |
cggtgatggcgagaaatagaaaaggttccggtgtgacgcacgtgtttttgcatgatgtggatcggaaggttgagaaagtttatgccgaagaatttctttg |
34715073 |
T |
 |
| Q |
235 |
taagaagaatttggttaaaggtgttggaaggctttggca |
273 |
Q |
| |
|
|| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34715072 |
taggaagaatttggtgaaaggtgttggtaggctttggca |
34715034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 229
Target Start/End: Original strand, 10189258 - 10189323
Alignment:
| Q |
164 |
ggtgtgacgcatgtgtttttgcatgatgtggatcgtagggttgagaaactttatgctgatgagttt |
229 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| | ||||||||||||||||||| | |||||| |
|
|
| T |
10189258 |
ggtgtgacgcatgtgtttcttcatgatgtggatagggaggttgagaaactttatgctaaggagttt |
10189323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University