View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12448_high_10 (Length: 382)
Name: NF12448_high_10
Description: NF12448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12448_high_10 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0010 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 14 - 372
Target Start/End: Original strand, 149056 - 149414
Alignment:
| Q |
14 |
agaataaagatgaagcctgaaaatgagtttataatgagtggtatccattactaggttgttccagcctgaaataaaaacccaataggttgttccagcctcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149056 |
agaataaagatgaagcctgaaaatgagtttataatgagtggtatccatcactaggttgttccagcctgaaataaaaacccaataggttgttccagcctcg |
149155 |
T |
|
| Q |
114 |
tcatcttggattcctaagctactgaatgaattcactctagtcctacaggaggccatcagaaatttacaggacatataggcaggctgctcaatctctatac |
213 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149156 |
tcatcttggattcctaagctactgtaggaattcactctagtcctacaggaggccatcagaaatttacaggacatataggcaggctgctcaatctctatac |
149255 |
T |
|
| Q |
214 |
tggccaaggtcgaaagggactctatttcagatattgtttcaacacgttctatttgtccacggaacaaatgtctagcagcttaacctgcaagaactctcca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
149256 |
tggccaaggtcgaaagggactctatttcagacattgtttcaacacgctctatttgtccacggaacaaatatctagcagcttaacctgcaagaactctcca |
149355 |
T |
|
| Q |
314 |
acccttgcccatccctaatgccatttgggaggaaattagtatcgacttcatcacaggtt |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
149356 |
acccttgcccatccctaatgccatttgggaggaaattagtatcgaattcatcacaggtt |
149414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University