View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12448_high_11 (Length: 348)
Name: NF12448_high_11
Description: NF12448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12448_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 4 - 337
Target Start/End: Original strand, 48965700 - 48966032
Alignment:
| Q |
4 |
accacacatgtgatctgacctttctacattttctgattcactacatatgatgtttgcatcattgttttgttggcttttgcatttgatcattcaacattgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
48965700 |
accacacatgtgatctgacctttctacattttctgattaactacatatgatgtttgctacattgttttgttggcttt-gcattggatcattcaacattgc |
48965798 |
T |
 |
| Q |
104 |
atctgtttactaaaacaaaaatcacaaacactgataatgaatgttaattagtctaatttaagaaccagcaatagcagcaatgcctggtgctctttcgtaa |
203 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48965799 |
atctgtttactaaaaagaaaatcacaaacactaataatgaatgttaattagtataatttaagaaccagcaatagcagcaatgcctggtgctctttcttaa |
48965898 |
T |
 |
| Q |
204 |
gagcaacaaactgtgatgtgaggccaaatggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatgtggctgcaatccaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965899 |
gagcaacaaactgtgatgtgaggccaaatggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatgtggctgcaatccaa |
48965998 |
T |
 |
| Q |
304 |
gctctcttgccagtggtaatttcttcacaggttc |
337 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |
|
|
| T |
48965999 |
gctctcttgccagttgtaatttctttacaggttc |
48966032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University