View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12448_high_17 (Length: 235)
Name: NF12448_high_17
Description: NF12448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12448_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 11280084 - 11279862
Alignment:
| Q |
10 |
gcagcagagagaaatttatgcattaatttgacatctttggaacctgaatgtgaa-gcttggattttgaaggagaaacctatgttctcacgtttgctacaa |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11280084 |
gcagcagtgagaaatttatgcattaatttgacatctttggaacctgaatgtgaaagcttggattttgaaggagaaacctatgttctcacgtttgctacaa |
11279985 |
T |
 |
| Q |
109 |
gagaggatagatttcagcttcactttggcctttaccacacaaaaaagattaggggatttctctggcagtcacgcagatagattaaaaagctattgtatca |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11279984 |
gacaggatagatttcagcttcactttggcctttaccacacaaaaaagattaggggatttctctggtagtcacgcagatagattaaaaagctattgtatca |
11279885 |
T |
 |
| Q |
209 |
cttttgttttttcatttgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11279884 |
attttgttttttcatttgatgtc |
11279862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University