View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_high_12 (Length: 344)
Name: NF12449_high_12
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 200 - 327
Target Start/End: Original strand, 6246239 - 6246362
Alignment:
| Q |
200 |
tgtatggttagggttattagattcgtggaatttgggtttcctaatttaattactgcttgtcacgtgcgcacacacacttagtcagttacctttccttttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6246239 |
tgtatggttagggttattagattcgtggaatttgggtttcctaatttaattactgcttgtcacgtgcgcacacacacttagtcagttacctttccttt-- |
6246336 |
T |
|
| Q |
300 |
tgtttgtttctttgtttaagcagttggt |
327 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6246337 |
--tttgtttctttgtttaagcagttggt |
6246362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 6245825 - 6245944
Alignment:
| Q |
19 |
gctgaagaagcagaggttgttgctgaaaatcaattaatacaggaagtcgaagacatagtggatgttgctgtaaatgcaatagcccagtaattttaaggct |
118 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6245825 |
gctgaagaagcagagtttgttactgataatcaattaatacatgaagtccaagacatagtggctgttgctgtaaatgcaatagcccagtaattttaaggct |
6245924 |
T |
|
| Q |
119 |
gatctacaaggatgttgatt |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6245925 |
gatctacaaggatgttgatt |
6245944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University