View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_high_5 (Length: 413)
Name: NF12449_high_5
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 37502935 - 37502769
Alignment:
| Q |
19 |
gatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagcaacagctcgtttctgcttctgtctcatagtctgcgctgtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37502935 |
gatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagtaacagctcgtttctgcttctgcctcatagtctgcgctgtgt |
37502836 |
T |
 |
| Q |
119 |
agcacaccaaccattaagcaagtatcttgcttgcactgccacctacatcgcagtctcaagaatgcta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37502835 |
ggcacaccaaccattaagcaagtatcttgcttgcactgccacctacatcgcagtctcaagaatgcta |
37502769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University