View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_high_8 (Length: 354)
Name: NF12449_high_8
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 14 - 336
Target Start/End: Original strand, 12843870 - 12844192
Alignment:
| Q |
14 |
gcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttg |
113 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843870 |
gcagagactaaccggaatcatatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttg |
12843969 |
T |
|
| Q |
114 |
ccgggagtccattgaacgccaaggccgacaacgagattacggttacggagattacggttgcggcgaaggtattgaaggtggcggagggattgaaaatgat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843970 |
ccgggagtccattgaacgccaaggccgacaatgagattacggttacagagattacggttgcggcgaaggtattgaaggtggcggagggattgaaaatgat |
12844069 |
T |
|
| Q |
214 |
gattgagcatactttggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttcatgaatgtagacatggtaagt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844070 |
gattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttcatgaatgtagacatggtaagt |
12844169 |
T |
|
| Q |
314 |
gcgaaagttttcatatctgccac |
336 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
12844170 |
gcgaaggttttcatatctgccac |
12844192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 14 - 163
Target Start/End: Complemental strand, 12861611 - 12861462
Alignment:
| Q |
14 |
gcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861611 |
gcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttg |
12861512 |
T |
|
| Q |
114 |
ccgggagtccattgaacgccaaggccgacaacgagattacggttacggag |
163 |
Q |
| |
|
| | ||||||||||||||| ||||||||||| ||||||| ||| ||||| |
|
|
| T |
12861511 |
cggttagtccattgaacgccgaggccgacaacaagattacagttgcggag |
12861462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 194 - 332
Target Start/End: Complemental strand, 12861467 - 12861329
Alignment:
| Q |
194 |
gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca |
293 |
Q |
| |
|
||||||| |||||| ||||||| ||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861467 |
gcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtggcggtaacggtgacttcgaagttgatttggctttcg |
12861368 |
T |
|
| Q |
294 |
tgaatgtagacatggtaagtgcgaaagttttcatatctg |
332 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12861367 |
tgaatgtagacatggtaagtgcgaaggttttcatatctg |
12861329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University