View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_low_18 (Length: 320)
Name: NF12449_low_18
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 35617920 - 35617611
Alignment:
| Q |
1 |
gtactagtaccatgtttaagatcttcctgcacaatactcttctcctgcactttatattcgccttcggctgttacttcctcctccaatatcccagtatcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35617920 |
gtactagtaccatgtttaagatcttccttcacaatactcttctcctgcactttatattcgccttcggctgttacttcctcctccattatcccagtatcgc |
35617821 |
T |
|
| Q |
101 |
aaactggaaacttgactgtttttgttgctgttgatttcacagtagcactttcatcatttttcttacatgcatccatattcttgtcattccttgctctctc |
200 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35617820 |
aaaccggaaacttgactgcttttgttgctgttgatttcacagtagcactttcatcatttttcttacatgcatccatattcttgtcattccttgctctctc |
35617721 |
T |
|
| Q |
201 |
agttacctcaaaatcccttccgtcgtttatttcttccttgctatgattcgaggaagcatcaagtgattgaatcagatttgcatgagactccaccgttgca |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35617720 |
agttacctcaaaatcccttctgtcgtttatttcttccttgctatgattcgaggaagcatcaagtgattgaatcagatttgcatgagactccaccgttgca |
35617621 |
T |
|
| Q |
301 |
gaagtctgtg |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
35617620 |
gaagtctgtg |
35617611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University