View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_low_29 (Length: 226)
Name: NF12449_low_29
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 38 - 213
Target Start/End: Original strand, 3613495 - 3613670
Alignment:
| Q |
38 |
tggggtggctgatccaaagagttttgttgataatgtttacatgtttgttagtaagaatgttgaaatgaactttgatgtacgtgatatgggcattttgaat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3613495 |
tggggtggctgatccaaagagttttgttgataatgtttacatgtttgttagtaagaatgttgaaatgaactttgatgtacgtgatatgggcattttgaat |
3613594 |
T |
|
| Q |
138 |
gctgataacatgtctgtcactgatattgcttggaggaatctcaatgatgtcgctagtaatcggttgaatttgaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3613595 |
gctgataacatgtctgtcactgatgttgcttggaggaatctcaacgatgtcgctagtaatcggttgaatttgaaga |
3613670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 14757300 - 14757469
Alignment:
| Q |
20 |
gggtataggtcctgcacttggggtggctgatccaaagagttttgttgataatgtttacatgtttgttagtaagaatgttgaaatgaactttgatgtacgt |
119 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
14757300 |
gggtataggtcctgctgttggagaggctgatccaaagagtgttgttgataatgtttacatgtttgttagtaaaaatgctgaaatgaactttgatgtacgt |
14757399 |
T |
|
| Q |
120 |
gatatgggcattttgaatgctgataacatgtctgtcactgatattgcttggaggaatctcaatgatgtcg |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| || ||||||| |
|
|
| T |
14757400 |
gatatgggcattttaaatgctgataacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcg |
14757469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University