View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_low_30 (Length: 221)
Name: NF12449_low_30
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 53111693 - 53111558
Alignment:
| Q |
18 |
agcaactccttattcacatataccggtgtagtacagcctatacggtgtagtatcccttttccttcttaccttgatgtttgactaaatttgtagcagatgg |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53111693 |
agcaactccttattcacatatactggtgtagtatagcctatacggtgtagtatcccttttccttcttaccttgatgtttgactaaatttgtagcagatgg |
53111594 |
T |
 |
| Q |
118 |
atgatttttcatctgatcatgctgcctttttggaaa |
153 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| |
|
|
| T |
53111593 |
atgatttttcatctgatcatgctgccattttagaaa |
53111558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University