View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12449_low_30 (Length: 221)

Name: NF12449_low_30
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12449_low_30
NF12449_low_30
[»] chr4 (1 HSPs)
chr4 (18-153)||(53111558-53111693)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 53111693 - 53111558
Alignment:
18 agcaactccttattcacatataccggtgtagtacagcctatacggtgtagtatcccttttccttcttaccttgatgtttgactaaatttgtagcagatgg 117  Q
    ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53111693 agcaactccttattcacatatactggtgtagtatagcctatacggtgtagtatcccttttccttcttaccttgatgtttgactaaatttgtagcagatgg 53111594  T
118 atgatttttcatctgatcatgctgcctttttggaaa 153  Q
    |||||||||||||||||||||||||| |||| ||||    
53111593 atgatttttcatctgatcatgctgccattttagaaa 53111558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University