View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12449_low_32 (Length: 204)
Name: NF12449_low_32
Description: NF12449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12449_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 15 - 182
Target Start/End: Complemental strand, 38943579 - 38943412
Alignment:
| Q |
15 |
cagagacagtcaccaaaaggttaaccgcttcagagagggtgatctcattgcagttcctactggtactgtattttggatgtacaatgaccaggagactcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38943579 |
cagagacagtcaccaaaaggttaaccgcttcagagagggtgatctcattgcagttcctaccggtactgtattttggatgtacaatgaccaggacactcca |
38943480 |
T |
|
| Q |
115 |
gttattgctatttcccttactgacaccggcagcttccaaaatcaacttgatgagatgcctagggtgag |
182 |
Q |
| |
|
|| ||||| |||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38943479 |
gtcattgccgtttctcttattgacactggcagcttccaaaatcaacttgatgagatgcctagggtgag |
38943412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 15 - 182
Target Start/End: Complemental strand, 38951057 - 38950890
Alignment:
| Q |
15 |
cagagacagtcaccaaaaggttaaccgcttcagagagggtgatctcattgcagttcctactggtactgtattttggatgtacaatgaccaggagactcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38951057 |
cagagacagtcaccaaaaggttaaccgcttcagagagggtgatctcattgcagttcctaccggtactgtattttggatgtacaatgaccaggacactcca |
38950958 |
T |
|
| Q |
115 |
gttattgctatttcccttactgacaccggcagcttccaaaatcaacttgatgagatgcctagggtgag |
182 |
Q |
| |
|
|| ||||| |||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38950957 |
gtcattgccgtttctcttattgacactggcagcttccaaaatcaacttgatgagatgcctagggtgag |
38950890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University