View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_high_18 (Length: 374)
Name: NF1244_high_18
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_high_18 |
 | |
|
| [»] scaffold0565 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0565 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 280
Target Start/End: Original strand, 5201 - 5471
Alignment:
| Q |
10 |
aataatatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5201 |
aataaaatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaat |
5300 |
T |
|
| Q |
110 |
gccattgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5301 |
gccattgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctata |
5400 |
T |
|
| Q |
210 |
tatgtagtggtggatgaggcaaagatttctaaaggcttttacgtatggttgaggatattttggtagaagct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5401 |
tatgtagtggtggatgaggcaaagatttctaaaggcttttacgtacggttgaggatattttggtagaagct |
5471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University