View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_high_26 (Length: 251)
Name: NF1244_high_26
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 34749896 - 34749685
Alignment:
| Q |
7 |
ttttctaatatgccatattgatgttgataggtcatttagtatatgctactagcatatgcacatgtaacatgtctgttgttgagacttggatacttggata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749896 |
ttttctaatatgccatattgatgttgataggtcatttagtatatgcta---gcatatgcacatgtaacatgtctgttgttgagacttggatacttggata |
34749800 |
T |
|
| Q |
107 |
ctaccagacaccagtaataataatactaatcgattacaatgaatatatatagcattggctctcatgcatatttgctttattataatggttatatgcttta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749799 |
ctaccagacaccagtaataataatactaatcgattacaagga--atatatagcattggctctcatgcatatttgctttattataatggttatatgcttta |
34749702 |
T |
|
| Q |
207 |
tacggtgatctcttgtt |
223 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
34749701 |
tagggtgatctcttgtt |
34749685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University