View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_15 (Length: 436)
Name: NF1244_low_15
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 11 - 407
Target Start/End: Complemental strand, 51365152 - 51364773
Alignment:
| Q |
11 |
cataggctcgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagtttcttttggctttatttgatt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51365152 |
cataggcttgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagtttcttttggctttatttgatt |
51365053 |
T |
|
| Q |
111 |
tttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatggtgttctctctcttgtaaccttgaagtggtgtgtgac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51365052 |
tttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatggtgttctctctcttgtaatcttgaagtggtgtgtgac |
51364953 |
T |
|
| Q |
211 |
cgttgttcatacttgtttttccattttgcatgtttagtttcatgtccttctaatttgtggaatgacaaggtggattgaagtggcgtgttccctttgtaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
51364952 |
cgttgttcatacttgtttttccattttgcatgtttagtttcatgtccttctaatttgtggaatgacaaggtggattgaagtggtgtgttctctttgtaat |
51364853 |
T |
|
| Q |
311 |
ttatttttggatgtttaatgatttagtatcgaataatattgcagttggagcggcactggcgttcgttggggtgggagcttgtaggattgcacggaag |
407 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51364852 |
ttatttttggatgtt-----------------ataatattgcagttggagcggcactggcgttcgttggggtgggagcttgtaggattgcacggaag |
51364773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 247 - 285
Target Start/End: Original strand, 53870213 - 53870251
Alignment:
| Q |
247 |
gtttcatgtccttctaatttgtggaatgacaaggtggat |
285 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
53870213 |
gtttcatgcccttctaatttgtggagtgacaaggtggat |
53870251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University