View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_22 (Length: 393)
Name: NF1244_low_22
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 30 - 313
Target Start/End: Original strand, 26952573 - 26952857
Alignment:
| Q |
30 |
ttttttgaatggattatctctaataacttgattgctaaagtgatcccttcttccttgattaattaggatgatttcaatatatccgaaataccttctttgg |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
26952573 |
ttttttgaatggattatctctaatgacttgattgctaaagtgatcccttcttccttgattaatcaggatgatttcaatatatccgaaataccttcttttg |
26952672 |
T |
 |
| Q |
130 |
aagatgtcaaggcctctta-tagggatgatgttcacttggttaacctaagttttttaaacatgacaaataagaaaatattaacataattctttaaaaata |
228 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26952673 |
aagatgtcaaggcctcttaatagggatgatgttcacttggttaacctaagctttttaaacatgacaaataagaaaatattaacataattctttaaaaata |
26952772 |
T |
 |
| Q |
229 |
attcgatatttagttaagatctcatttttagttaatggcaagcatggtttatttcttttccaaaagagggtgtaaggcatgggag |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26952773 |
attcgatatttagttaagatctcatttttagttaatggcaagcatggtttatttcttttccaaaagagggtgtaaggcatgggag |
26952857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University