View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_31 (Length: 313)
Name: NF1244_low_31
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 116 - 236
Target Start/End: Original strand, 45101376 - 45101496
Alignment:
| Q |
116 |
gtgatgcgatgactagtgttgtctcacccttaaaggtatataagaaaacgtgggaaggaaaggaaacaccgagagcgaacaataataatacgataatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45101376 |
gtgatgcgatgactagtgttgtctcacccttaaaggtatataagaaaacgtgggaaggaaaggaaacaccgagagcgaacaataataatacgacaatttt |
45101475 |
T |
 |
| Q |
216 |
ttctcaccaaataaatccaat |
236 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
45101476 |
ttctcaccaaacaaatccaat |
45101496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University