View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_32 (Length: 304)
Name: NF1244_low_32
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 100 - 216
Target Start/End: Complemental strand, 34624434 - 34624318
Alignment:
| Q |
100 |
aagttgtactgtaattttatttttt-catcaaatagtcatgtcatttaattactatagcattgttacatagacatgactatttgattgcttacttgtcta |
198 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34624434 |
aagttgtactgtaattttttttttttcatcaaatagtcatgtcatt-aattactatagcattgttacatagacatgactatttgattgcttacttgtcta |
34624336 |
T |
|
| Q |
199 |
atctttgaaaagggtgat |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34624335 |
atctttgaaaagggtgat |
34624318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University