View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_34 (Length: 300)
Name: NF1244_low_34
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 86 - 242
Target Start/End: Complemental strand, 24566643 - 24566487
Alignment:
| Q |
86 |
cataacaagttaccttctttatcttatggaagtatccatcacgtgaacatatttgatttgacaattgacgggtaacagatatggacaagatacgatttat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566643 |
cataacaagttaccttctttatcttatggaagtatccatcacgtgaacatatttgatttgacaattgacgggtaacagatatggacaagatacgatttat |
24566544 |
T |
|
| Q |
186 |
gaaattacgatcacttgaattgatgaaactgaattttatcaagttgtttttctgtgt |
242 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24566543 |
gaaattatgatcacttgaattgatgaaactgaattttatcaagttgttttcctgtgt |
24566487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 195 - 242
Target Start/End: Original strand, 45532459 - 45532506
Alignment:
| Q |
195 |
atcacttgaattgatgaaactgaattttatcaagttgtttttctgtgt |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
45532459 |
atcacttgaatttatgaaactgaattttatcaagtttttttcctgtgt |
45532506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University