View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_39 (Length: 270)
Name: NF1244_low_39
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 30 - 223
Target Start/End: Complemental strand, 52153218 - 52153025
Alignment:
| Q |
30 |
ttatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaaggaaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153218 |
ttatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaagggaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgtt |
52153119 |
T |
 |
| Q |
130 |
ctttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153118 |
ctttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
52153025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University