View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_40 (Length: 270)
Name: NF1244_low_40
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 31 - 234
Target Start/End: Original strand, 7128063 - 7128266
Alignment:
| Q |
31 |
ttctctctctctgatcactttaatctacggaattgttgctaataaaagtctatctcttccgttggatcttgtttgcttcctatctgcctcacttttaaga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128063 |
ttctctctctctgatcactttaatctacggaattgttgctaataaaagtctatctcttccgttggatcttgtttgcttcctatctgcctcacttttaaga |
7128162 |
T |
|
| Q |
131 |
tagtctgttgttatccaagaaagagatggtctaaacatttacacacactagtcaagaaattcaatagtcttgatctgtcccttgcaataattctagagct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128163 |
tagtctgttgttatccaagaaagagatggtctaaacatttacacacgctagtcaagaaattcaatagtcttgatctgtcccttgcaataattctagagct |
7128262 |
T |
|
| Q |
231 |
tggt |
234 |
Q |
| |
|
|||| |
|
|
| T |
7128263 |
tggt |
7128266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University