View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_44 (Length: 248)
Name: NF1244_low_44
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 36254103 - 36254241
Alignment:
| Q |
17 |
tttattctaaacgtaggttcattgtaattttatctcattgatagatcggtatggtatcacatatatacatgaatactcatattagactgaatatcataca |
116 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||| |||||| |
|
|
| T |
36254103 |
tttattctaaacttaggttcatagtaattttatctcattgatagc-cggtatggtatcacatatatacatgaatactcacattagactggataccataca |
36254201 |
T |
|
| Q |
117 |
agtccatccattagataaaattacgagtattcatgaatac |
156 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36254202 |
aattcatccattagataaaattacgagtattcatgaatac |
36254241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 36254263 - 36254312
Alignment:
| Q |
182 |
aatagttttatcacatatatacatgaatactcgtatcatgagatactttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36254263 |
aatagttttatcacatatatacatgaatactcgtatcatgagatactttt |
36254312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University