View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1244_low_47 (Length: 224)
Name: NF1244_low_47
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1244_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 40221827 - 40221647
Alignment:
| Q |
15 |
aatatgaagtgctagcattttacaggatgcaattatgtgctcgtattctatgcatattattgggttagatatttctttggtacttttgttttgtttttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40221827 |
aatatgaagtgctagcattttacaggatgcaattatgtgctcgtattctatgcatattattgggatagatatttctttggtacttttgttttgtttttca |
40221728 |
T |
|
| Q |
115 |
atatcagacaaacttggagtcactcaagccagagacaaaaactgattgtttgtatctcaaaaatatcaattgctaaattgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40221727 |
atatcagacaaacttggagtcactcaagccagagacaaaaactgattgtttgtatctcaaaaatatcaattgctagattgt |
40221647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University