View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12451_high_7 (Length: 280)
Name: NF12451_high_7
Description: NF12451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12451_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 8 - 262
Target Start/End: Complemental strand, 43715134 - 43714880
Alignment:
| Q |
8 |
ggagaagcagagagaaggattccctgagagaacgttcaatggaagcttctcgaagaacggtgtgtttggaacgtggcctgagaatttgttgaatgagata |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43715134 |
ggagaagcaaagagaaggattccctgagagaacgttcaatggaagcttctcgaagaacggtgtgtttggaacgtgacctgagaatttgttgaatgagata |
43715035 |
T |
 |
| Q |
108 |
ttgagaacaacgagattttccaatccggcaagataatcaaggtttccggtgagaatgttgtgagataaatcaagaactccgagttttgttaagcttgaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43715034 |
ttgagaacaacgagattttccaatccggcaagataatcaaggtttccggtgagaatgttgtgagataaatcaagaactccgagttttgttaagcttgaaa |
43714935 |
T |
 |
| Q |
208 |
actcgtgaggaatcttgccggaaagttggtttgtgctcagatttaaagctatttc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43714934 |
actcgtgaggaatcttgccggaaagttggtttgtgctcagatttaaagctatttc |
43714880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University