View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12451_low_16 (Length: 248)
Name: NF12451_low_16
Description: NF12451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12451_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 39123579 - 39123360
Alignment:
| Q |
17 |
cacagagttacacgccttaaaatgagtagcatatttaaacagtttcattcttctcccttataaatccaaaggaactgatttgaccctgcttttttctttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123579 |
cacagagttacacgccttaaaatgagtagcatatttaaacagtttcattcttctcccttataaatccaaaggaactgatttgaccctgcttttttctttt |
39123480 |
T |
|
| Q |
117 |
gtaagatattaaaccaagtcaaattgaataaaatgatggccatgtctcactactactctccctatgactgttactacttactatcaacgtgattgggcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123479 |
gtaagatattaaaccaagtcaaattgaataaaatgatggccatgtctcactactactctccctatgactgttactacttactatcaacgtgattgggcat |
39123380 |
T |
|
| Q |
217 |
tgacaagcaagacacaggtt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39123379 |
tgacaagcaagacacaggtt |
39123360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University