View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12452_low_1 (Length: 384)
Name: NF12452_low_1
Description: NF12452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12452_low_1 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 94 - 384
Target Start/End: Complemental strand, 29403412 - 29403122
Alignment:
| Q |
94 |
atatattgagaaagtaattagagaaagaaatggtgaatttaatagaaagaagagttgaaatcatggctgatgaagggtgctcacattcataatagaagga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29403412 |
atatattgagaaagtaattagagaaagaaatggtgaatttaatagaaagaagagttgaaatcatggctgatgaagggtgctcacattcataatagaagga |
29403313 |
T |
 |
| Q |
194 |
tataagaaaagatatggagtgtcaccttctattcttcttcaaatcatattggattatgaatttgctaattgaaattagtggtcaaagttgataaaatgga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
29403312 |
tataagaaaagatatggagtgtcaccttctattcttcttcaaatcatattggattatgaatttgctaattaaaattagtgttcaatgttgataaaatgga |
29403213 |
T |
 |
| Q |
294 |
gatgggatataaagagttagagtgagagaaaatttggagattgtagaagagatggttgaattttggtcaccataacgaattttatggggaa |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29403212 |
gatgggatataaagagttagagtgagagaaaatttggagattgtagaagagatggttgaattttggtcaccataacgaattttatggggaa |
29403122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 29403490 - 29403442
Alignment:
| Q |
16 |
caatcacaagtcttctttacaagcaatcaaattttttgatttagttctg |
64 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29403490 |
caatcacaagttttctttacaagcaatcaaagtttttgatttagttctg |
29403442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 151
Target Start/End: Complemental strand, 29403099 - 29403071
Alignment:
| Q |
123 |
atggtgaatttaatagaaagaagagttga |
151 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29403099 |
atggtgaatttaatagaaagaagagttga |
29403071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University