View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12453_low_10 (Length: 344)
Name: NF12453_low_10
Description: NF12453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12453_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 12 - 327
Target Start/End: Complemental strand, 40396770 - 40396457
Alignment:
| Q |
12 |
tgtgttggatattgagcacgccatccatgaagtctcgacactacaatggttttatcacatatgtatgctttcaaagtaaaaaagaaataatttggtcatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40396770 |
tgtgttggatattgagcacgccatccatgaagtctcgacactacaatggttttatcacat--gtatactttcaaagtaaaaaagaaataatttggtcatg |
40396673 |
T |
|
| Q |
112 |
aatcagaaactagaagttcattccaaatgatatccatatctaaagatggcattctacttaactgaacagtttcgacatcacatatctcattctgtgtaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40396672 |
aatcagaaactagaagttcattccaaatgatatccatatctaaagatggcattctacttaactgaacagtttcgacatcacatatctcattctgtgtact |
40396573 |
T |
|
| Q |
212 |
tttgcttctctcagttatgtcacctacaaccttcaactcctttatactttcatcctttccatttttaatctcatcaatgtgcctattgtttaaccttgct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40396572 |
tttgcttctctcagttatgtcacctacaaccttcaactcctttatactttcatcctttccatttttaatctcatcaatgtgcctattgtttaaccttgct |
40396473 |
T |
|
| Q |
312 |
gatgaatcaccttgct |
327 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40396472 |
gatgaatcaccttgct |
40396457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University