View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12453_low_14 (Length: 294)
Name: NF12453_low_14
Description: NF12453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12453_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 25813957 - 25813699
Alignment:
| Q |
19 |
cttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagtatcgctagcgtatactttgctcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813957 |
cttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagtatcgctagcgtatactttgctcca |
25813858 |
T |
 |
| Q |
119 |
tcgtgaccttgttgtaaggccatttctagaaaatttctagcagaatcatagtttgaaatttgatagcaaatatctaggatacccattcgaaagcaatact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25813857 |
tcgtgaccttgttgtaaggccatttctagaaaatttctagtagaatcatagtttgaaatttgatagcaaatatctaggatacccattctaaagcaatact |
25813758 |
T |
 |
| Q |
219 |
ctggatttctactagattctaacaattggtaaaaagaatccctatttccatcgactttg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25813757 |
ctggatttctactagattctaacaattggtaaagagaatccctatttccatcgactttg |
25813699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University