View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12453_low_15 (Length: 279)
Name: NF12453_low_15
Description: NF12453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12453_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 3087067 - 3087303
Alignment:
| Q |
19 |
ttagaggccaactgcattcaattattgttttttgcgatatagttatgattagtttttggaagggtgctcgattagcctgaaatgactgctttgctcaact |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087067 |
ttagaggccaactgcattcaatcattgttttttgcgatatagttatgattagtttttggaagggtgctcgattagcctgaaatgactgctttgctcaact |
3087166 |
T |
 |
| Q |
119 |
atttatgtcatctattctttgagatattttaccattattttacttcaataatgaatcaatattacctcttgttttagcaccagttaatgcatcaatcatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087167 |
atttatgtcatctattctttgagatattttaccattattttacttcaataatgaatcaatattacctcttgttttagcaccagttaatgcatcaatcatg |
3087266 |
T |
 |
| Q |
219 |
catctaacttgcatgtataaataaatgactttgcatccgtt |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3087267 |
catctaacttgcatgt----ataaatgactttgcatccgtt |
3087303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University