View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12453_low_5 (Length: 417)
Name: NF12453_low_5
Description: NF12453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12453_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 133 - 400
Target Start/End: Original strand, 37760733 - 37761001
Alignment:
| Q |
133 |
acccttgcttatttaccatttcaacgttcaaaatgaacaattaacaaagaattcaagcnnnnnnnacgctgttttttcatcatagatactctcttttata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37760733 |
acccttgcttatttaccatttcaacgttcaaaatgaacaattaacaaagaattcaagctttctttacgctgttttttcatcatagatactctcttttata |
37760832 |
T |
 |
| Q |
233 |
ttaacaatggcatttttccgttgcaactacaagaaacataaatggtacacacattctcgtttctttctttgagagattcttctcctccattctttttgga |
332 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37760833 |
ttaacaatggtatttttccgttgcaactacaagaaacaaaaatggtacacacattctcgtttctttctttgagagattcttctcctccattctttttgga |
37760932 |
T |
 |
| Q |
333 |
aaattagattttctagatgcattgcttttttaccatggt-aaaaatattgtttttcaccatagtgaaaa |
400 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37760933 |
aaattagattttctagatacattgcttttttaccatggtaaaaaatattgtttttcaccatagtgaaaa |
37761001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 37760613 - 37760659
Alignment:
| Q |
16 |
tgacgtggtaggatgcgaatatgcagaaacaaaattctcgattatac |
62 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
37760613 |
tgacgtggtagaatgcgattatgcagaaacaaaattctcgattatac |
37760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University