View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12455_high_2 (Length: 357)
Name: NF12455_high_2
Description: NF12455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12455_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 50475610 - 50475365
Alignment:
| Q |
1 |
cctcccttcaatttccagttccagccatagtcgtagcttttttgttggtccttcttatagtagtaagcaacacattcgcagcagcatcacgataaagtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50475610 |
cctcccttcaatttccagttccagccatagtcgtagcttttttgttgctcctt---atagtagtaagcaacacattcgcagca---tcacgataaagtgt |
50475517 |
T |
 |
| Q |
101 |
gtgaaggtggatacagaagaaacaaatatcatgtgtgatccttgcaatgggaaaggatggttggtctgtgacttttgtgaaggccaaaagactaatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50475516 |
gtgaaggtggatacagaagaaacaaatatcatgtgtgatccttgcaatgggaaaggatggttggtctgtgacttttgtgaaggccaaaagactaatgtca |
50475417 |
T |
 |
| Q |
201 |
aagccccaaacaaccgtatctaccgtcgatgtccatcctgcaaagccgtacg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50475416 |
aagccccaaacaaccgtatctaccgtcgatgtccatcctgcaaagccgtacg |
50475365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University