View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12455_low_4 (Length: 266)
Name: NF12455_low_4
Description: NF12455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12455_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 33405601 - 33405839
Alignment:
| Q |
19 |
tttcctatcaattatatttatcgctatccttctgtagtgaatgtgtttttgttgatttcttcctgaagttggatcgccatgttttaagttgttacttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33405601 |
tttcctatcaattatatttatcgctatccttctgtagtgaatgtgtttttgttgatttcttcctgaagttggatcgccatgttttaagttgttacttgtt |
33405700 |
T |
 |
| Q |
119 |
acaataaaa-aagttgaagatgtcatgattggatgttatctaactactgctcttttatgtttcaacacagatgaagctgctttgatccttattcgacacg |
217 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33405701 |
acattaaaaaaagttgaagatgtcatgattggatgttatctaactactgctcttttatgttccaacacagatgaagctgctttgatccttattcgacacg |
33405800 |
T |
 |
| Q |
218 |
gtgagtcgttgtggaatgagaagaatttgttcacaggtt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33405801 |
gtgagtcgttgtggaatgagaagaatttgttcacaggtt |
33405839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University