View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12455_low_6 (Length: 223)
Name: NF12455_low_6
Description: NF12455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12455_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 28939389 - 28939591
Alignment:
| Q |
12 |
agatggtcatcacagccccaatcttctcttgcccatttgcaaaattcgaagtccttgtacagaacatcttcatatcctgagcagctaaggcaagatcaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28939389 |
agatggtcatcacagccccaatcttctcttgcccatttgcaaaattcgaagtccttgtacagaacatcttcatatcctgagcagctaaggcaagagcaaa |
28939488 |
T |
|
| Q |
112 |
actaccacctccaacattgctctagtgagcctgttcacaactggcttgatcagcatatttatgatattgaaacagctcatgatgacaaacgatgtccatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
28939489 |
actaccacctccaacattgctctagtgagccagttcacaactggcttgatcagcatatttatgatattgaaacagctcatgatgagaaacgatggtcatc |
28939588 |
T |
|
| Q |
212 |
tca |
214 |
Q |
| |
|
||| |
|
|
| T |
28939589 |
tca |
28939591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 103
Target Start/End: Original strand, 28953852 - 28953938
Alignment:
| Q |
17 |
gtcatcacagccccaatcttctcttgcccatttgcaaaattcgaagtccttgtacagaacatcttcatatcctgagcagctaaggca |
103 |
Q |
| |
|
|||||||||||| | |||||| |||||| ||| ||| | || || |||||||| ||||| ||||| ||||||||||||| |||||| |
|
|
| T |
28953852 |
gtcatcacagccttattcttcttttgcccctttacaagaatcaaactccttgtatagaacttcttcgtatcctgagcagcaaaggca |
28953938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University